Review



sequence-based reagent qpcr β-actin (forward primer)  (Eurofins)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Eurofins sequence-based reagent qpcr β-actin (forward primer)

    Sequence Based Reagent Qpcr β Actin (Forward Primer), supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence-based reagent qpcr β-actin (forward primer)/product/Eurofins
    Average 90 stars, based on 1 article reviews
    sequence-based reagent qpcr β-actin (forward primer) - by Bioz Stars, 2026-02
    90/100 stars

    Images

    1) Product Images from "Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration"

    Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

    Journal: eLife

    doi: 10.7554/eLife.57356


    Figure Legend Snippet:

    Techniques Used: In Situ, SYBR Green Assay, Sequencing



    Similar Products

    90
    Eurofins sequence-based reagent qpcr β-actin (forward primer)

    Sequence Based Reagent Qpcr β Actin (Forward Primer), supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sequence-based reagent qpcr β-actin (forward primer)/product/Eurofins
    Average 90 stars, based on 1 article reviews
    sequence-based reagent qpcr β-actin (forward primer) - by Bioz Stars, 2026-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: eLife

    Article Title: Met and Cxcr4 cooperate to protect skeletal muscle stem cells against inflammation-induced damage during regeneration

    doi: 10.7554/eLife.57356

    Figure Lengend Snippet:

    Article Snippet: Sequence-based reagent , CCAGTTGGTAACAATGCCATGT , Eurofins , N/A , qPCR β-actin (forward primer).

    Techniques: In Situ, SYBR Green Assay, Sequencing